ID: 1132600516_1132600529

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132600516 1132600529
Species Human (GRCh38) Human (GRCh38)
Location 16:770705-770727 16:770733-770755
Sequence CCATGGGAGCCGCCTGGGGGGAT GAGGGGGGCTGGGCTCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 132} {0: 2, 1: 0, 2: 1, 3: 52, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!