ID: 1132600984_1132600997

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132600984 1132600997
Species Human (GRCh38) Human (GRCh38)
Location 16:772863-772885 16:772896-772918
Sequence CCTGCCCGCCCACCCAGGTGCCC CTGGTTCTCCAGGGCCACGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 610} {0: 1, 1: 0, 2: 2, 3: 20, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!