ID: 1132601088_1132601096

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1132601088 1132601096
Species Human (GRCh38) Human (GRCh38)
Location 16:773315-773337 16:773335-773357
Sequence CCCTGGGGGGTGTGTGGGGTCCA CCAGGCTGGTAACCGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 235} {0: 1, 1: 0, 2: 0, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!