ID: 1132601088_1132601102

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132601088 1132601102
Species Human (GRCh38) Human (GRCh38)
Location 16:773315-773337 16:773359-773381
Sequence CCCTGGGGGGTGTGTGGGGTCCA CCAACCACCACTGCTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 235} {0: 1, 1: 0, 2: 2, 3: 19, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!