ID: 1132617439_1132617448

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1132617439 1132617448
Species Human (GRCh38) Human (GRCh38)
Location 16:848742-848764 16:848768-848790
Sequence CCGTCCACCTTCTCCCTGCCCAG CTCTGTGGGTTTCCCTGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 124, 4: 1027} {0: 1, 1: 4, 2: 64, 3: 393, 4: 1194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!