ID: 1132622318_1132622327

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132622318 1132622327
Species Human (GRCh38) Human (GRCh38)
Location 16:873646-873668 16:873685-873707
Sequence CCCCTGCGCTCGCGGGGACCCTC TGTGTTCCAGGTGGGCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141} {0: 1, 1: 0, 2: 0, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!