ID: 1132622852_1132622859

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1132622852 1132622859
Species Human (GRCh38) Human (GRCh38)
Location 16:875885-875907 16:875907-875929
Sequence CCAGCAGCTGGGACCCCAGGACC CGCATGGCTGAAGACGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 120, 4: 1675} {0: 1, 1: 0, 2: 4, 3: 75, 4: 1248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!