ID: 1132623210_1132623212

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132623210 1132623212
Species Human (GRCh38) Human (GRCh38)
Location 16:878024-878046 16:878052-878074
Sequence CCAAACACACATGGGGTCTGGCT GAACCGACTGAAGCTATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114} {0: 2, 1: 0, 2: 2, 3: 5, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!