ID: 1132626838_1132626842

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132626838 1132626842
Species Human (GRCh38) Human (GRCh38)
Location 16:895266-895288 16:895290-895312
Sequence CCTGGTCGGGTCAGCCTCGGGCT CCAGTAGAATCCTCCTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76} {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!