ID: 1132640213_1132640223

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1132640213 1132640223
Species Human (GRCh38) Human (GRCh38)
Location 16:974758-974780 16:974775-974797
Sequence CCCCCAGCACCCCGGCCTGGCAG TGGCAGCTCCCGCCTCCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 492} {0: 1, 1: 0, 2: 0, 3: 19, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!