ID: 1132641702_1132641712

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132641702 1132641712
Species Human (GRCh38) Human (GRCh38)
Location 16:981121-981143 16:981165-981187
Sequence CCGCGGCCCCTTGAAGCGCGTTA GACTCTGGACGAGCTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14} {0: 1, 1: 0, 2: 2, 3: 22, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!