ID: 1132656689_1132656700

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1132656689 1132656700
Species Human (GRCh38) Human (GRCh38)
Location 16:1044472-1044494 16:1044488-1044510
Sequence CCCGCCCGGGGCCGCCTGGGGGG TGGGGGGCCGAGGTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 385} {0: 1, 1: 0, 2: 11, 3: 151, 4: 1134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!