ID: 1132665644_1132665656

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132665644 1132665656
Species Human (GRCh38) Human (GRCh38)
Location 16:1080266-1080288 16:1080301-1080323
Sequence CCCATGCCGGCCTTCCCTCTGGG CAGAAGGCCGGCCAGGCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 168} {0: 1, 1: 1, 2: 0, 3: 16, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!