ID: 1132665676_1132665680

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132665676 1132665680
Species Human (GRCh38) Human (GRCh38)
Location 16:1080390-1080412 16:1080422-1080444
Sequence CCCCGTCCAAGGCTGCTCTGCTA CACCCGAAAGCGCTTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 144} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!