ID: 1132665678_1132665680

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1132665678 1132665680
Species Human (GRCh38) Human (GRCh38)
Location 16:1080392-1080414 16:1080422-1080444
Sequence CCGTCCAAGGCTGCTCTGCTAAG CACCCGAAAGCGCTTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 173} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!