ID: 1132665918_1132665934

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132665918 1132665934
Species Human (GRCh38) Human (GRCh38)
Location 16:1081270-1081292 16:1081315-1081337
Sequence CCGTGCTCCCGCCGTCTGCCCAG GGGCACAGGGAGCGGCTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 257} {0: 1, 1: 0, 2: 5, 3: 58, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!