ID: 1132666308_1132666322

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132666308 1132666322
Species Human (GRCh38) Human (GRCh38)
Location 16:1082798-1082820 16:1082840-1082862
Sequence CCTGGCTGGTTCCTGCTTGGAGC CGGGGTCTGATGGCCTCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!