ID: 1132673378_1132673386

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132673378 1132673386
Species Human (GRCh38) Human (GRCh38)
Location 16:1111640-1111662 16:1111674-1111696
Sequence CCACCCACCTTGGCCTTACAAAG CAGGCATGAGCCACCGTGCCCGG
Strand - +
Off-target summary {0: 9, 1: 1202, 2: 25860, 3: 80100, 4: 159731} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!