ID: 1132692460_1132692464

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1132692460 1132692464
Species Human (GRCh38) Human (GRCh38)
Location 16:1187687-1187709 16:1187704-1187726
Sequence CCTGCTTGGGGGCCACTCTGACC CTGACCATAGAGGAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 178} {0: 1, 1: 1, 2: 0, 3: 34, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!