ID: 1132694184_1132694189

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132694184 1132694189
Species Human (GRCh38) Human (GRCh38)
Location 16:1194740-1194762 16:1194755-1194777
Sequence CCGGGCCTGGGACCCTCACGGAG TCACGGAGCAGAGCCCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 248} {0: 1, 1: 1, 2: 1, 3: 19, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!