ID: 1132694185_1132694196

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1132694185 1132694196
Species Human (GRCh38) Human (GRCh38)
Location 16:1194745-1194767 16:1194781-1194803
Sequence CCTGGGACCCTCACGGAGCAGAG AGGCCCCAGGCGCCACCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211} {0: 1, 1: 0, 2: 6, 3: 36, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!