ID: 1132694185_1132694200

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132694185 1132694200
Species Human (GRCh38) Human (GRCh38)
Location 16:1194745-1194767 16:1194792-1194814
Sequence CCTGGGACCCTCACGGAGCAGAG GCCACCTGGTGGCTGCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211} {0: 1, 1: 0, 2: 5, 3: 19, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!