ID: 1132694187_1132694206

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1132694187 1132694206
Species Human (GRCh38) Human (GRCh38)
Location 16:1194752-1194774 16:1194800-1194822
Sequence CCCTCACGGAGCAGAGCCCGGCC GTGGCTGCTTTCAGGAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119} {0: 1, 1: 0, 2: 3, 3: 35, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!