ID: 1132694188_1132694200

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132694188 1132694200
Species Human (GRCh38) Human (GRCh38)
Location 16:1194753-1194775 16:1194792-1194814
Sequence CCTCACGGAGCAGAGCCCGGCCA GCCACCTGGTGGCTGCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170} {0: 1, 1: 0, 2: 5, 3: 19, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!