ID: 1132696083_1132696093

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132696083 1132696093
Species Human (GRCh38) Human (GRCh38)
Location 16:1202558-1202580 16:1202601-1202623
Sequence CCAGCTTTGACTTGTGAAACAGA CATAAGAAGGGGAAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 159} {0: 1, 1: 0, 2: 3, 3: 58, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!