ID: 1132700251_1132700255

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1132700251 1132700255
Species Human (GRCh38) Human (GRCh38)
Location 16:1219190-1219212 16:1219209-1219231
Sequence CCTCGTCTCATCTGAAGGACCAG CCAGCAGACGAGGACAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180} {0: 1, 1: 0, 2: 0, 3: 21, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!