ID: 1132716248_1132716257

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1132716248 1132716257
Species Human (GRCh38) Human (GRCh38)
Location 16:1291545-1291567 16:1291571-1291593
Sequence CCCCCTCGCCCAGCTCCTGAGAT ACCGGGAAGCTGCTGATCACCGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 8, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!