ID: 1132729633_1132729639

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132729633 1132729639
Species Human (GRCh38) Human (GRCh38)
Location 16:1355059-1355081 16:1355086-1355108
Sequence CCGCGTCTGCGGGGTCGGGTGTG GTCTCCCGCGTCTGCGGGGTCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 4, 4: 84} {0: 1, 1: 4, 2: 4, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!