ID: 1132729642_1132729649

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132729642 1132729649
Species Human (GRCh38) Human (GRCh38)
Location 16:1355091-1355113 16:1355119-1355141
Sequence CCGCGTCTGCGGGGTCGGGTGTG TCTCCCGCCTCTGCGGGGTCGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 4, 4: 84} {0: 1, 1: 1, 2: 4, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!