ID: 1132736205_1132736212

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1132736205 1132736212
Species Human (GRCh38) Human (GRCh38)
Location 16:1387384-1387406 16:1387407-1387429
Sequence CCCTATCCCTTGCACTTCCTGTC CCTGCTTCAGACCCTCAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 81, 4: 875} {0: 1, 1: 0, 2: 0, 3: 31, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!