ID: 1132737379_1132737391

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132737379 1132737391
Species Human (GRCh38) Human (GRCh38)
Location 16:1393678-1393700 16:1393712-1393734
Sequence CCGAGCTGGGGCGGACAGACCCC AGGGAGGTGGTGCTCCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 65, 4: 1387} {0: 1, 1: 0, 2: 7, 3: 49, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!