ID: 1132738002_1132738009

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1132738002 1132738009
Species Human (GRCh38) Human (GRCh38)
Location 16:1397026-1397048 16:1397049-1397071
Sequence CCTCATGCCTCCACCCCCAGGCT TCCCGACCTGTGCCAGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 705} {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!