ID: 1132745241_1132745256

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1132745241 1132745256
Species Human (GRCh38) Human (GRCh38)
Location 16:1433678-1433700 16:1433716-1433738
Sequence CCAGGGCCCCCAGGTGAGGCTGA GATTCCAGGTGAGCAGCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 408} {0: 1, 1: 0, 2: 0, 3: 23, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!