ID: 1132745469_1132745473

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132745469 1132745473
Species Human (GRCh38) Human (GRCh38)
Location 16:1434478-1434500 16:1434491-1434513
Sequence CCTCCTGGCCTCCGCAGGGCCCT GCAGGGCCCTGAGCTTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 456} {0: 1, 1: 0, 2: 0, 3: 12, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!