ID: 1132746120_1132746126

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1132746120 1132746126
Species Human (GRCh38) Human (GRCh38)
Location 16:1437016-1437038 16:1437038-1437060
Sequence CCGAGGGCCCGTGGGGGCTGTTC CCGACCACACAGGTGCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162} {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!