ID: 1132746289_1132746304

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1132746289 1132746304
Species Human (GRCh38) Human (GRCh38)
Location 16:1437715-1437737 16:1437746-1437768
Sequence CCGGCCTGTCAGGCCTCTACCCT TGGTGGGCTGAGAGCTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 274} {0: 1, 1: 0, 2: 3, 3: 51, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!