ID: 1132746630_1132746641

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1132746630 1132746641
Species Human (GRCh38) Human (GRCh38)
Location 16:1438928-1438950 16:1438968-1438990
Sequence CCGAGGCCTTCATTCTCTGTGGG TGCAGGTCTGCGTCTGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 221} {0: 1, 1: 0, 2: 2, 3: 10, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!