ID: 1132746661_1132746664

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132746661 1132746664
Species Human (GRCh38) Human (GRCh38)
Location 16:1439036-1439058 16:1439063-1439085
Sequence CCAGGAAGCTCTTCTGCAGGAAG ACAGCTTGGCCTCCCTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 307} {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!