ID: 1132749020_1132749042

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132749020 1132749042
Species Human (GRCh38) Human (GRCh38)
Location 16:1448841-1448863 16:1448884-1448906
Sequence CCCAGAGGCCGCCCCCAGAAACC CGGCTGTTTGGAGGCTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154} {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!