ID: 1132758161_1132758165

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132758161 1132758165
Species Human (GRCh38) Human (GRCh38)
Location 16:1495998-1496020 16:1496011-1496033
Sequence CCATGCTCGCTCTGTTTTCCCTG GTTTTCCCTGGGGCGCCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 336} {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!