ID: 1132759051_1132759068

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132759051 1132759068
Species Human (GRCh38) Human (GRCh38)
Location 16:1500175-1500197 16:1500220-1500242
Sequence CCTGGCTCTCCGTCCCTGCGAGG GGCTCACCTTTTGGGCGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162} {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!