ID: 1132759056_1132759068

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132759056 1132759068
Species Human (GRCh38) Human (GRCh38)
Location 16:1500188-1500210 16:1500220-1500242
Sequence CCCTGCGAGGCCCTGGGAGAAGA GGCTCACCTTTTGGGCGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 1, 3: 31, 4: 265} {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!