ID: 1132760738_1132760742

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132760738 1132760742
Species Human (GRCh38) Human (GRCh38)
Location 16:1507447-1507469 16:1507471-1507493
Sequence CCTCGAGGTGGCTGACAGGCAGC TGGCCTGGTACTTCCCAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136} {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!