ID: 1132763179_1132763189

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1132763179 1132763189
Species Human (GRCh38) Human (GRCh38)
Location 16:1520901-1520923 16:1520932-1520954
Sequence CCTCGGCTCAGCGGCGGCTTCTG GGGTGGGTATGGAGGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 151} {0: 1, 1: 2, 2: 9, 3: 96, 4: 702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!