ID: 1132763244_1132763252

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1132763244 1132763252
Species Human (GRCh38) Human (GRCh38)
Location 16:1521351-1521373 16:1521392-1521414
Sequence CCACCGTGCCGGCCTGATTTTCC ATATATTTTTTTCTGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 775} {0: 1, 1: 0, 2: 9, 3: 136, 4: 1649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!