ID: 1132771427_1132771439

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1132771427 1132771439
Species Human (GRCh38) Human (GRCh38)
Location 16:1565593-1565615 16:1565619-1565641
Sequence CCCGTCCTGCTTTCCTGCCCTGC CCTGGCTCACGCAGGCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 728} {0: 1, 1: 0, 2: 10, 3: 25, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!