ID: 1132775677_1132775687

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132775677 1132775687
Species Human (GRCh38) Human (GRCh38)
Location 16:1592598-1592620 16:1592626-1592648
Sequence CCCAACACCACGTGTTAGGACAG CCGGCAGAGCGACTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} {0: 2, 1: 3, 2: 6, 3: 4, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!