ID: 1132796304_1132796317

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1132796304 1132796317
Species Human (GRCh38) Human (GRCh38)
Location 16:1724998-1725020 16:1725039-1725061
Sequence CCCCACCTCTTCACACTGCTGAG AGGCAGGAGGGTGGGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 334} {0: 1, 1: 0, 2: 3, 3: 39, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!