ID: 1132799077_1132799087

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132799077 1132799087
Species Human (GRCh38) Human (GRCh38)
Location 16:1742639-1742661 16:1742674-1742696
Sequence CCCTCTGCTGGCGCCAGGGGAAC CAGTAACACCACAGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182} {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!