ID: 1132808384_1132808395

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1132808384 1132808395
Species Human (GRCh38) Human (GRCh38)
Location 16:1786340-1786362 16:1786368-1786390
Sequence CCCCCGGGTCTGGGGCTGCAGGG GCCTGGAGGTCTTTACATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 507} {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!